ID: 924908760_924908766

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 924908760 924908766
Species Human (GRCh38) Human (GRCh38)
Location 1:248486094-248486116 1:248486144-248486166
Sequence CCCCAAGTTAAACATGCATTAAG GTACAGAAGAAGAATGAACAGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 17, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!