ID: 924927752_924927756

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 924927752 924927756
Species Human (GRCh38) Human (GRCh38)
Location 1:248699686-248699708 1:248699706-248699728
Sequence CCTTCAATCCACCAGAGAGATGA TGATCAAAAGCCAAGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!