ID: 924941222_924941228

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 924941222 924941228
Species Human (GRCh38) Human (GRCh38)
Location 1:248813424-248813446 1:248813460-248813482
Sequence CCCATGTTCTTGCCTAGTGTCAC TACTCAGCTTTGCTGCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 96} {0: 1, 1: 0, 2: 0, 3: 24, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!