ID: 924949473_924949477

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 924949473 924949477
Species Human (GRCh38) Human (GRCh38)
Location 1:248868849-248868871 1:248868894-248868916
Sequence CCAACTATATGTTGCCTACAAAG ACACATATACTGAAAGTAAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 37, 2: 375, 3: 1542, 4: 9672}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!