ID: 924953381_924953399

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 924953381 924953399
Species Human (GRCh38) Human (GRCh38)
Location 1:248906131-248906153 1:248906181-248906203
Sequence CCGCGGAGGTCCTGGAGTCTCGA GCCCGGGGGCGTGGCATGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77} {0: 1, 1: 1, 2: 1, 3: 31, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!