ID: 924985753_924985760

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 924985753 924985760
Species Human (GRCh38) Human (GRCh38)
Location 2:268038-268060 2:268056-268078
Sequence CCGATTTTCAGACCCCTGTTTTA TTTTAGGTCCAGATCTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 233} {0: 1, 1: 0, 2: 0, 3: 24, 4: 414}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!