ID: 924987693_924987698

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 924987693 924987698
Species Human (GRCh38) Human (GRCh38)
Location 2:287358-287380 2:287387-287409
Sequence CCGCGCCGCAGCTCACGCGCGCC AGACCAGGCGCTTCTCCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 199} {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!