ID: 924993421_924993426

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 924993421 924993426
Species Human (GRCh38) Human (GRCh38)
Location 2:336151-336173 2:336190-336212
Sequence CCTCCAGATGCTGGAGAAGGGAA TAGAGCCCCCAAAAGAAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 11, 3: 156, 4: 919} {0: 1, 1: 0, 2: 1, 3: 27, 4: 256}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!