ID: 925030606_925030613

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 925030606 925030613
Species Human (GRCh38) Human (GRCh38)
Location 2:647812-647834 2:647847-647869
Sequence CCCAGGATCTGCTGCATGCCCGG GCTGCATTGTCAGCTGCTCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 142} {0: 1, 1: 0, 2: 0, 3: 15, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!