ID: 925064053_925064060

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 925064053 925064060
Species Human (GRCh38) Human (GRCh38)
Location 2:915251-915273 2:915298-915320
Sequence CCAATGACTGGGCACCACAGGGA ACCCACATGCAGAAGATGGAAGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 0, 3: 16, 4: 194} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!