ID: 925069056_925069067

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 925069056 925069067
Species Human (GRCh38) Human (GRCh38)
Location 2:951504-951526 2:951532-951554
Sequence CCAGTTTGAGCCCAGCCAGGTGC GCGGCCTCGGCAGGTGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 176} {0: 1, 1: 0, 2: 1, 3: 30, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!