ID: 925075963_925075967

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 925075963 925075967
Species Human (GRCh38) Human (GRCh38)
Location 2:1015850-1015872 2:1015878-1015900
Sequence CCCAGCATCATCTGTATCTGCTG CAAGACAAAAGACTTGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 219} {0: 1, 1: 0, 2: 1, 3: 28, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!