ID: 925077789_925077794

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 925077789 925077794
Species Human (GRCh38) Human (GRCh38)
Location 2:1032947-1032969 2:1032971-1032993
Sequence CCAATCGCGGCAGAATGCAAAGC GGGGCAGTCATGTCACATGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 266} {0: 1, 1: 2, 2: 8, 3: 42, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!