ID: 925082325_925082338

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 925082325 925082338
Species Human (GRCh38) Human (GRCh38)
Location 2:1080081-1080103 2:1080111-1080133
Sequence CCCCCAGGGCGGTGGCGAGGGGG CTGGGCAATGGTGTGGCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 39, 4: 254} {0: 1, 1: 0, 2: 2, 3: 34, 4: 473}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!