ID: 925084572_925084575

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 925084572 925084575
Species Human (GRCh38) Human (GRCh38)
Location 2:1097885-1097907 2:1097910-1097932
Sequence CCTCGTTTCTTCATGGAGCTCCG CCTCACAAGCAGAATGCAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83} {0: 1, 1: 1, 2: 2, 3: 24, 4: 230}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!