ID: 925098483_925098494

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 925098483 925098494
Species Human (GRCh38) Human (GRCh38)
Location 2:1226431-1226453 2:1226477-1226499
Sequence CCCAGCACCAACTGGGAATACAG CCATCAGTATGGAAAGACACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 235} {0: 1, 1: 0, 2: 0, 3: 14, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!