ID: 925114591_925114602

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 925114591 925114602
Species Human (GRCh38) Human (GRCh38)
Location 2:1367726-1367748 2:1367765-1367787
Sequence CCAGTCCACCTGATGCAGTTCAC CAGCAGCATGAGAACCATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 103} {0: 1, 1: 1, 2: 1, 3: 44, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!