ID: 925123505_925123510

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 925123505 925123510
Species Human (GRCh38) Human (GRCh38)
Location 2:1437748-1437770 2:1437771-1437793
Sequence CCGGCTGGAAGAGGCAGCCTGTG CTGAACACAGAGATGGGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 60, 4: 576} {0: 1, 1: 0, 2: 5, 3: 21, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!