ID: 925149626_925149636

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 925149626 925149636
Species Human (GRCh38) Human (GRCh38)
Location 2:1606321-1606343 2:1606348-1606370
Sequence CCTCTGCGGACCCCAAATTTCCC TGGGATATTAAAGTACATGACGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 1, 3: 11, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!