ID: 925162772_925162780

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925162772 925162780
Species Human (GRCh38) Human (GRCh38)
Location 2:1697705-1697727 2:1697721-1697743
Sequence CCGTCCTCCTGCAGTGACGTCTC ACGTCTCCCCAGGGGGCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 444} {0: 1, 1: 0, 2: 0, 3: 7, 4: 143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!