ID: 925167526_925167533

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 925167526 925167533
Species Human (GRCh38) Human (GRCh38)
Location 2:1727275-1727297 2:1727324-1727346
Sequence CCAGCGGCTGCCCCTCCTTCAGA TTTATCGCACTTAAATGTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 241} {0: 1, 1: 0, 2: 1, 3: 3, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!