ID: 925182731_925182743

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 925182731 925182743
Species Human (GRCh38) Human (GRCh38)
Location 2:1827444-1827466 2:1827472-1827494
Sequence CCTCATTCCCGCCACCCTCTGCC GGGGATCTCAGAGAGTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 72, 4: 748} {0: 1, 1: 0, 2: 1, 3: 16, 4: 183}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!