ID: 925182732_925182741

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 925182732 925182741
Species Human (GRCh38) Human (GRCh38)
Location 2:1827451-1827473 2:1827470-1827492
Sequence CCCGCCACCCTCTGCCTAGAAGG AAGGGGATCTCAGAGAGTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 278} {0: 1, 1: 1, 2: 0, 3: 21, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!