ID: 925182737_925182749

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 925182737 925182749
Species Human (GRCh38) Human (GRCh38)
Location 2:1827455-1827477 2:1827495-1827517
Sequence CCACCCTCTGCCTAGAAGGGGAT ACCTCTCTGGTTGGGAAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 142} {0: 1, 1: 0, 2: 0, 3: 16, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!