ID: 925182740_925182746

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 925182740 925182746
Species Human (GRCh38) Human (GRCh38)
Location 2:1827465-1827487 2:1827487-1827509
Sequence CCTAGAAGGGGATCTCAGAGAGT TTGAGGGGACCTCTCTGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 159} {0: 1, 1: 0, 2: 2, 3: 11, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!