ID: 925186360_925186371

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 925186360 925186371
Species Human (GRCh38) Human (GRCh38)
Location 2:1849449-1849471 2:1849495-1849517
Sequence CCTGGTGAAGCCACATCAATGTC CTGTGGCAGTGGTCCCCCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 113} {0: 1, 1: 0, 2: 1, 3: 18, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!