ID: 925194462_925194463

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925194462 925194463
Species Human (GRCh38) Human (GRCh38)
Location 2:1912034-1912056 2:1912050-1912072
Sequence CCTGTTGCTGTTGACATGCCCGC TGCCCGCGCCCCGTGCAGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 0, 3: 21, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!