ID: 925214964_925214967

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 925214964 925214967
Species Human (GRCh38) Human (GRCh38)
Location 2:2086610-2086632 2:2086629-2086651
Sequence CCTTAGCTGAAGGTCCCTGGCTT GCTTCTGCCTGCCCTGCTGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 144} {0: 1, 1: 0, 2: 7, 3: 47, 4: 379}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!