ID: 925219468_925219482

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 925219468 925219482
Species Human (GRCh38) Human (GRCh38)
Location 2:2126410-2126432 2:2126452-2126474
Sequence CCATGTGTTCACCACCACCCCTG TCTGGGGCCCAGAAAGAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 83, 4: 502} {0: 1, 1: 0, 2: 4, 3: 39, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!