ID: 925224928_925224938

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 925224928 925224938
Species Human (GRCh38) Human (GRCh38)
Location 2:2175561-2175583 2:2175612-2175634
Sequence CCTGACAAAAGCCCACCTCAGAC CTCTGTGAACTGAGTTTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149} {0: 1, 1: 0, 2: 2, 3: 12, 4: 208}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!