ID: 925232986_925232990

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 925232986 925232990
Species Human (GRCh38) Human (GRCh38)
Location 2:2252412-2252434 2:2252425-2252447
Sequence CCCACCACAAGCTGTTCTTCCTA GTTCTTCCTATTGAGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 209} {0: 1, 1: 2, 2: 0, 3: 14, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!