ID: 925235446_925235450

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 925235446 925235450
Species Human (GRCh38) Human (GRCh38)
Location 2:2273333-2273355 2:2273364-2273386
Sequence CCCTGATAAATGAGATGTTTGGA AGACCAATACAGAAAGTGGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 230} {0: 1, 1: 0, 2: 5, 3: 28, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!