ID: 925244392_925244398

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 925244392 925244398
Species Human (GRCh38) Human (GRCh38)
Location 2:2367427-2367449 2:2367453-2367475
Sequence CCATCTGTGGGGCGGGCCTGGCT TCATAACTTTAGGGCAGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!