ID: 925294187_925294194

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 925294187 925294194
Species Human (GRCh38) Human (GRCh38)
Location 2:2767001-2767023 2:2767023-2767045
Sequence CCCGCCTGCAGCCACCATGGTGG GAGGCAGCCTGAGAAGAGAATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 6, 3: 54, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!