ID: 925312273_925312275

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 925312273 925312275
Species Human (GRCh38) Human (GRCh38)
Location 2:2893445-2893467 2:2893484-2893506
Sequence CCTGCATTATTATCATTGATTAC TGGTTGTACATGCAAGTTTCAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!