ID: 925318094_925318107

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 925318094 925318107
Species Human (GRCh38) Human (GRCh38)
Location 2:2940404-2940426 2:2940446-2940468
Sequence CCCCTGAGCCTGTCCCCTGCCAG CCCCAGAGCCTGCCCCTGCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 13, 3: 67, 4: 587} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!