|
Left Crispr |
Right Crispr |
| Crispr ID |
925360079 |
925360084 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:3272555-3272577
|
2:3272603-3272625
|
| Sequence |
CCGGTTGATGGAGCATTCAAAAC |
TCTTACATGGGCATGGTTCGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 16, 3: 97, 4: 276} |
{0: 2, 1: 11, 2: 79, 3: 195, 4: 481} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|