ID: 925386178_925386192

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 925386178 925386192
Species Human (GRCh38) Human (GRCh38)
Location 2:3463406-3463428 2:3463445-3463467
Sequence CCCCGAGATCCCTTCTCTGCCGC GAATCCAGCTTCCTCTCACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 194} {0: 1, 1: 0, 2: 4, 3: 21, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!