ID: 925396367_925396379

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 925396367 925396379
Species Human (GRCh38) Human (GRCh38)
Location 2:3536416-3536438 2:3536447-3536469
Sequence CCTCCGAGTCCCCTCGTGGACCA CCTTGGGCTCTGTCCTGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61} {0: 1, 1: 0, 2: 6, 3: 30, 4: 407}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!