ID: 925411621_925411628

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 925411621 925411628
Species Human (GRCh38) Human (GRCh38)
Location 2:3643033-3643055 2:3643054-3643076
Sequence CCTTCAGCTCCCCTCAGCCCTGC GCAGTGCCCCCAAGCCATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 98, 4: 858} {0: 1, 1: 0, 2: 2, 3: 15, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!