ID: 925418675_925418676

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925418675 925418676
Species Human (GRCh38) Human (GRCh38)
Location 2:3692707-3692729 2:3692723-3692745
Sequence CCTACAACATGGTGTTGCTGAAC GCTGAACAGCAACTCTGATTTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 13, 3: 51, 4: 160} {0: 2, 1: 27, 2: 69, 3: 69, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!