ID: 925427348_925427351

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 925427348 925427351
Species Human (GRCh38) Human (GRCh38)
Location 2:3761581-3761603 2:3761624-3761646
Sequence CCTGAGGATGCAACAGCCAGGTT CTTTAATAAATGTTCAAAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 174} {0: 1, 1: 0, 2: 3, 3: 31, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!