ID: 925428858_925428860

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 925428858 925428860
Species Human (GRCh38) Human (GRCh38)
Location 2:3773916-3773938 2:3773951-3773973
Sequence CCAGTTATTTTTAGAGAGTCTCA AAAAGGAGAGTATCTTTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 9, 4: 225} {0: 1, 1: 0, 2: 1, 3: 36, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!