ID: 925429371_925429376

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925429371 925429376
Species Human (GRCh38) Human (GRCh38)
Location 2:3778022-3778044 2:3778038-3778060
Sequence CCTCCATCAGTAGGTTACCTGAG ACCTGAGTGGCTGTGTGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 127} {0: 1, 1: 2, 2: 1, 3: 28, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!