ID: 925429398_925429403

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925429398 925429403
Species Human (GRCh38) Human (GRCh38)
Location 2:3778146-3778168 2:3778162-3778184
Sequence CCTCCATCAGTGGGTTTCCTGAG TCCTGAGTGGCTGTGTGGACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 260} {0: 1, 1: 1, 2: 7, 3: 151, 4: 5453}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!