ID: 925434760_925434772

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 925434760 925434772
Species Human (GRCh38) Human (GRCh38)
Location 2:3827261-3827283 2:3827294-3827316
Sequence CCTTGTTGGACACCAAAAGGCAA AAGGGGAGGCAGCAGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 119} {0: 1, 1: 0, 2: 18, 3: 168, 4: 1336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!