ID: 925435097_925435099

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 925435097 925435099
Species Human (GRCh38) Human (GRCh38)
Location 2:3830202-3830224 2:3830218-3830240
Sequence CCTAAATGCATCTCTGCAGTTTC CAGTTTCCCAAATATTTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 345} {0: 1, 1: 0, 2: 2, 3: 15, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!