ID: 925456868_925456874

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 925456868 925456874
Species Human (GRCh38) Human (GRCh38)
Location 2:4023469-4023491 2:4023497-4023519
Sequence CCTGCTGCAGCCAGCTCAGTGTC GTGATCTTGGCACTGGCATATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 7, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!