ID: 925511869_925511880

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 925511869 925511880
Species Human (GRCh38) Human (GRCh38)
Location 2:4636801-4636823 2:4636853-4636875
Sequence CCCCACTCAGCCTCCCTCCTTCA ATTTAGTTCAGTAATAATTCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 109, 4: 845} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!