ID: 925556281_925556287

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 925556281 925556287
Species Human (GRCh38) Human (GRCh38)
Location 2:5134584-5134606 2:5134602-5134624
Sequence CCATGGTGAGGCATCTCCAGGAG AGGAGCCCGGGGATCAGCCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 202} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!